Anton V.
Projects and blogs
Life sciences
Bioinformatics
FASTQ
FASTQ Editor

FASTQ Editor

An online editor for biological sequences in the FASTQ format.

untitled.fastq — FASTQ Editor

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC651
@SEQ_ID
2
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
3
+
4
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

See also

FASTQ to FASTA Converter - Convert FASTQ files to FASTA format.
Sequence Logo Generator - Create sequence logos from FASTA alignments.
WebLogo in the browser - Bringing WebLogo to the browser + demo of a pure client side sequence logo maker.
BLAST WASM - Compiling the BLAST sequence search/alignment tool to WASM.
DESeq2 in the browser - Running DESeq2 in the browser.
Genome Browser - Explore the human genome.
Sequence Alignment Viewer - Open FASTA files in the browser.
Phylogenetic Tree Editor - An online visual editor for phylogenetic trees (WIP).
Phylogenetic Tree Builder - Reconstruct phylogenetic trees from protein or DNA/RNA sequence alignments.
Plasmid Map Generator - A tool to generate plasmid maps from GenBank files.
WikiPathways: A Wikipedia for biological pathways - An overview of the collaboratively edited structured pathway encyclopedia.
The RDF model of the Gene Ontology, demystified - An outline of the structure of the Gene Ontology RDF graph and ways to query it.
The ambitious challenge of finishing the human genome - Generating a complete human genome sequence, chromosome by chromosome.
Scalable genomic alignment with Progressive Cactus - How progressive alignment makes it possible to efficiently align hundreds to thousands of large genomes.
GenBank to FASTA - Convert GenBank flat files to FASTA format.
ABI to FASTA - Convert AB1 files (Applied Biosystems/ABI trace files) to FASTA format.
Awesome bioinformatics - A curated list of awesome resources on bioinformatics.
NCBI Taxonomy Browser - A simple tool for viewing the NCBI taxonomy tree.
What is FASTA and how is it used? - Learn about the FASTA format and its applications.
FASTA Editor - A FASTA editor for creating and editing FASTA files.
FASTA Parse Tree Viewer - Visualize the parse tree of FASTA files.
Newick Editor - An online editor for phylogenetic trees in the Newick format.
Newick Parse Tree Viewer - View the parse trees of Newick strings.
PDB Editor - Edit PDB files online.
PDB to FASTA - Extract protein/nucleotide sequences from PDB files.
Bioinformatics Crossword - A daily crossword puzzle for bioinformatics terms.
Bioinformatics pronunciation guide - A pronunciation guide for bioinformatics terms.

Made by Anton Vasetenkov.

If you want to say hi, you can reach me on LinkedIn or via email. If you like my work, you can support me by buying me a coffee.